Đăng nhập
 
Tìm kiếm nâng cao
 
Tựa bài viết
Tác giả
Năm xuất bản
Tóm tắt
Lĩnh vực
Phân loại
Số tạp chí
 

Bản tin định kỳ
Báo cáo thường niên
Tạp chí khoa học ĐHCT
Tạp chí tiếng anh ĐHCT
Tạp chí trong nước
Tạp chí quốc tế
Kỷ yếu HN trong nước
Kỷ yếu HN quốc tế
Book chapter
Tạp chí trong nước 2024
Số tạp chí 229(2024) Trang: 178-186
Tạp chí: Khoa học và công nghệ Đại học Thái Nguyên
Liên kết:

Bananas (Musa spp.) is an important crop which has high economic and nutritional values, but it is also very susceptible to diseases, especially anthracnose caused by Colletotrichum spp. In particular, Colletotrichum musae is the most common pathogen causing banana anthracnose and leading to yield loss. Therefore, developing a method for identification of C. musae has received a lot of attention from scientists, recently. In this study, Colletotrichum spp. were isolated from anthracnose lesions of different banana cultivars collected in Viet Nam including Can Tho, Da Lat, Hau Giang, Soc Trang and Vinh Long. Pathogenicity of fungal strains was tested using 3 common banana cultivars in Vietnam (Gia, Xiem and Cau). Specific primers for C. musae were designed on the glyceraldehyde-3- phosphate dehydrogenase (GADPH) gene sequence to accurately identify C. musae causing anthracnose on bananas. In this study, 11 strains of Colletotrichum spp. were isolated from anthracnose lesions. Of which, the G2 strain showed the highest pathogenicity (lesion diameter: 19.33 mm) while the CA strain had the lowest pathogenicity (lesion diameter: 7.44 mm). The two primers CM1 (5' CCGCTGTAATCTACATCTC 3') and CM2 (5' CTGATATGAGTGATAGCATGTA 3') were designed to generate the 115-bp DNA amplicon, a specific product for Colletotrichum musae. PCR results showed that 6/11 isolated fungal strains were identified as C. musae. These strains have the highest pathogenicity in the pathogenicity test, especially the G2 strain.

Các bài báo khác
Số tạp chí 22(2024) Trang: 1460-1467
Tạp chí: Tạp chí Khoa học Nông nghiệp Việt Nam
Số tạp chí 69(2024) Trang: 3–10
Tạp chí: Tạp chí Khoa học Trường Đại học Sư phạm Hà Nội: Khoa học Giáo dục
Số tạp chí 229(2024) Trang: 195-202
Tạp chí: TNU Journal of Science and Technology
Số tạp chí 40(2024) Trang: 107-115
Tạp chí: Tạp chí Khoa học: Khoa học tự nhiên và Công nghệ, Đại học Quốc gia Hà Nội
Số tạp chí 25/04(2024) Trang: 1/27--7/27
Tạp chí: Tạp Chí Ngân hàng
Số tạp chí tháng 6(2024) Trang: 77-84
Tạp chí: Tạp chí Pháp luật về Quyền con người
Số tạp chí tháng 5(2024) Trang: 58-64
Tạp chí: Tạp chí Kiểm sát


Vietnamese | English






 
 
Vui lòng chờ...